Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circ_EFCAB2 | |||
Gene | EFCAB2 | Organism | Human |
Genome Locus | chr1:245180544-245222760:n/a | Build | hg19 |
Disease | Temporal Lobe Epilepsy | ICD-10 | Malignant neoplasm of Long bones of lower limb (C40.2) |
DBLink | Link to database | PMID | 29428937 |
Experimental Method | |||
Sample Type | Brain Tissues | Comparison | Temporal cortices were collected from 17 Temporal Lobe Epilepsy (TLE) patients and 17 non-TLE patients |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GATCTGATTGCAGAGGGATAAT ReverseCACATCCACTGTATTATTCGAC | Statistics | Fold Change : Upregulated,3.388 pvalue : p<0.05 |
Citation | |||
Li, J, Lin, H, Sun, Z, Kong, G, Yan, X, Wang, Y, Wang, X, Wen, Y, Liu, X, Zheng, H, Jia, M, Shi, Z, Xu, R, Yang, S, Yuan, F (2018). High-Throughput Data of Circular RNA Profiles in Human Temporal Cortex Tissue Reveals Novel Insights into Temporal Lobe Epilepsy. Cell. Physiol. Biochem., 45, 2:677-691. |